ID: 1165156695_1165156710

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1165156695 1165156710
Species Human (GRCh38) Human (GRCh38)
Location 19:33793086-33793108 19:33793125-33793147
Sequence CCTTTAGTCTCCAGATTCTCTGG GAAGATTGGGGGGATTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 245} {0: 1, 1: 0, 2: 5, 3: 9, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!