ID: 1165159877_1165159889

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1165159877 1165159889
Species Human (GRCh38) Human (GRCh38)
Location 19:33809923-33809945 19:33809952-33809974
Sequence CCCAGGATAGAGCCCTGAGGAGC ATGGGGCAGGAGAGGCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 630} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!