ID: 1165182066_1165182070 |
View in Genome Browser |
Spacer: -5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1165182066 | 1165182070 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 19:33979925-33979947 | 19:33979943-33979965 |
Sequence | CCTCTCCTAGTCCAGAGTGGGTC | GGGTCAGCAGGATGAAAGAACGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |