ID: 1165221423_1165221432

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1165221423 1165221432
Species Human (GRCh38) Human (GRCh38)
Location 19:34319858-34319880 19:34319892-34319914
Sequence CCAACAGCAACCCACAACCTAAA GTCTTGTTTTCACAGGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 171} {0: 1, 1: 0, 2: 0, 3: 23, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!