ID: 1165225472_1165225475

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1165225472 1165225475
Species Human (GRCh38) Human (GRCh38)
Location 19:34351771-34351793 19:34351802-34351824
Sequence CCATTCACCACATGTGGCTATGT ATACAAATAAAAATTCAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 578} {0: 1, 1: 0, 2: 16, 3: 312, 4: 3478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!