ID: 1165243085_1165243094

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1165243085 1165243094
Species Human (GRCh38) Human (GRCh38)
Location 19:34482394-34482416 19:34482413-34482435
Sequence CCGCTCCAGCGTTTCCAGCCTCG CTCGGCTCCCGGGGCTCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160} {0: 1, 1: 0, 2: 3, 3: 23, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!