ID: 1165246883_1165246891

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1165246883 1165246891
Species Human (GRCh38) Human (GRCh38)
Location 19:34503040-34503062 19:34503078-34503100
Sequence CCTGCTCCATCCCGGTCACCATG TGGCCTGAGTCATCACAGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 231} {0: 1, 1: 0, 2: 0, 3: 16, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!