ID: 1165258603_1165258605

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1165258603 1165258605
Species Human (GRCh38) Human (GRCh38)
Location 19:34595160-34595182 19:34595175-34595197
Sequence CCTACATGTTGGGGACCAGCCTC CCAGCCTCAACACTACCCGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 431} {0: 3, 1: 16, 2: 24, 3: 20, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!