ID: 1165258603_1165258606

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1165258603 1165258606
Species Human (GRCh38) Human (GRCh38)
Location 19:34595160-34595182 19:34595176-34595198
Sequence CCTACATGTTGGGGACCAGCCTC CAGCCTCAACACTACCCGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 431} {0: 1, 1: 18, 2: 21, 3: 14, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!