ID: 1165272793_1165272805

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1165272793 1165272805
Species Human (GRCh38) Human (GRCh38)
Location 19:34724892-34724914 19:34724943-34724965
Sequence CCCCCTTCTCTGAAAAACCCCAG TCCAGACCCACCGGCCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 40, 4: 301} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!