ID: 1165274844_1165274847

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1165274844 1165274847
Species Human (GRCh38) Human (GRCh38)
Location 19:34739618-34739640 19:34739644-34739666
Sequence CCAGGTGAGTCATGGTGAACGAG AAGGAAGATTTTGTTAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 72} {0: 1, 1: 0, 2: 13, 3: 97, 4: 1167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!