ID: 1165279247_1165279256

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1165279247 1165279256
Species Human (GRCh38) Human (GRCh38)
Location 19:34782650-34782672 19:34782676-34782698
Sequence CCATGCTCCAGCTGTGAGGACAG CGCCTCTGGGGCAAGGGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!