ID: 1165283481_1165283486

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1165283481 1165283486
Species Human (GRCh38) Human (GRCh38)
Location 19:34817400-34817422 19:34817419-34817441
Sequence CCCAAGACCCTGGGGTGTTTGTG TGTGAATGTGTCCAAGGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 206} {0: 1, 1: 0, 2: 2, 3: 20, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!