ID: 1165301978_1165301986

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1165301978 1165301986
Species Human (GRCh38) Human (GRCh38)
Location 19:34975923-34975945 19:34975968-34975990
Sequence CCTTCTTCCACCACCAGTGTTTC TTAAATTAATCAGGGAAGAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!