ID: 1165312764_1165312769

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1165312764 1165312769
Species Human (GRCh38) Human (GRCh38)
Location 19:35038967-35038989 19:35038995-35039017
Sequence CCTACCCAAGGCTGGGTATTAAT CAGTGCATACACCAGGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103} {0: 1, 1: 0, 2: 1, 3: 13, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!