ID: 1165329077_1165329086

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1165329077 1165329086
Species Human (GRCh38) Human (GRCh38)
Location 19:35131472-35131494 19:35131517-35131539
Sequence CCCACGCTGGCATTCACGGTGGG ACGCGGCAGTCACACTGGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62} {0: 1, 1: 0, 2: 1, 3: 2, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!