ID: 1165329727_1165329736

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1165329727 1165329736
Species Human (GRCh38) Human (GRCh38)
Location 19:35134767-35134789 19:35134813-35134835
Sequence CCTCCATCCGCCTGCTGGCACGC TTCTCCGTCTTTCTTTCAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 102} {0: 1, 1: 0, 2: 1, 3: 29, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!