ID: 1165336380_1165336384

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1165336380 1165336384
Species Human (GRCh38) Human (GRCh38)
Location 19:35172965-35172987 19:35172978-35173000
Sequence CCACTCGAGCCTTGGCGTCCAGA GGCGTCCAGAGTTTTTACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!