ID: 1165338090_1165338095

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1165338090 1165338095
Species Human (GRCh38) Human (GRCh38)
Location 19:35187305-35187327 19:35187336-35187358
Sequence CCTCTAATCCCAACTACTCGGGA CAAGATAATCCCCTTGAACCTGG
Strand - +
Off-target summary {0: 11, 1: 1790, 2: 56608, 3: 231362, 4: 262047} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!