ID: 1165355291_1165355306

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1165355291 1165355306
Species Human (GRCh38) Human (GRCh38)
Location 19:35300235-35300257 19:35300283-35300305
Sequence CCCGCCGCTGCTGACCTGGATGC GGTGGCCGAGAGCCTGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 195} {0: 1, 1: 0, 2: 1, 3: 17, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!