ID: 1165370181_1165370188

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1165370181 1165370188
Species Human (GRCh38) Human (GRCh38)
Location 19:35400466-35400488 19:35400505-35400527
Sequence CCAGCCTGGGCAACACAGTGAGA AAAGAAAAAAGAAGGAAGGAGGG
Strand - +
Off-target summary No data {0: 44, 1: 425, 2: 2171, 3: 8409, 4: 27725}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!