ID: 1165380573_1165380581

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1165380573 1165380581
Species Human (GRCh38) Human (GRCh38)
Location 19:35476622-35476644 19:35476654-35476676
Sequence CCATTTCACCCTGTTGAAGTTCT TCCACAGTGCCGCCATTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 384} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!