ID: 1165385382_1165385386

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1165385382 1165385386
Species Human (GRCh38) Human (GRCh38)
Location 19:35507496-35507518 19:35507522-35507544
Sequence CCTCTTTGCTTATTTCCTAGGGA AGAAAACGGAGAGGAGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 227} {0: 1, 1: 0, 2: 1, 3: 38, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!