ID: 1165399029_1165399043

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1165399029 1165399043
Species Human (GRCh38) Human (GRCh38)
Location 19:35586002-35586024 19:35586046-35586068
Sequence CCAACCAATCCCTACCAGGGTGG GCTGCACTCTCTGTGTCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!