ID: 1165399036_1165399043

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1165399036 1165399043
Species Human (GRCh38) Human (GRCh38)
Location 19:35586016-35586038 19:35586046-35586068
Sequence CCAGGGTGGGCGGAGCCCACTTC GCTGCACTCTCTGTGTCTTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!