ID: 1165406374_1165406389

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1165406374 1165406389
Species Human (GRCh38) Human (GRCh38)
Location 19:35633661-35633683 19:35633706-35633728
Sequence CCCTCATGCTCTCCTCTTACCCA GAGAGCTGGGCCTAGGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 374} {0: 1, 1: 0, 2: 4, 3: 50, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!