ID: 1165406381_1165406389

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1165406381 1165406389
Species Human (GRCh38) Human (GRCh38)
Location 19:35633693-35633715 19:35633706-35633728
Sequence CCAGCAGCACCCCGAGAGCTGGG GAGAGCTGGGCCTAGGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 254} {0: 1, 1: 0, 2: 4, 3: 50, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!