ID: 1165421159_1165421167

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1165421159 1165421167
Species Human (GRCh38) Human (GRCh38)
Location 19:35722642-35722664 19:35722677-35722699
Sequence CCGGGCCATGGTGCCTGAAGATG GTGCCCTCCCTCTCCGGGATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 182} {0: 1, 1: 1, 2: 1, 3: 6, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!