ID: 1165422382_1165422389

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1165422382 1165422389
Species Human (GRCh38) Human (GRCh38)
Location 19:35728661-35728683 19:35728695-35728717
Sequence CCACATAGAGAGGGAGTAGCGGG GTTCAGGCTGGTTTGTGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87} {0: 1, 1: 1, 2: 0, 3: 11, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!