ID: 1165422714_1165422719

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1165422714 1165422719
Species Human (GRCh38) Human (GRCh38)
Location 19:35730300-35730322 19:35730320-35730342
Sequence CCCACCAATGCAGCCACCTCACT ACTTTGCCACCCCCTCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 241} {0: 1, 1: 0, 2: 2, 3: 33, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!