ID: 1165426188_1165426193

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1165426188 1165426193
Species Human (GRCh38) Human (GRCh38)
Location 19:35746681-35746703 19:35746706-35746728
Sequence CCTTCCAGCTTCTGTTTCCCATG AGATGTCTGGCGCTCAGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 469} {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!