ID: 1165461119_1165461131

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1165461119 1165461131
Species Human (GRCh38) Human (GRCh38)
Location 19:35944955-35944977 19:35944990-35945012
Sequence CCCACACCGTGGTCCAGCTGGAC GGGCCCGGCCACGAACCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 94} {0: 1, 1: 0, 2: 1, 3: 7, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!