ID: 1165461159_1165461168

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1165461159 1165461168
Species Human (GRCh38) Human (GRCh38)
Location 19:35945068-35945090 19:35945112-35945134
Sequence CCCGGACACCCTGTGGGACCTGG CATGGTTTTTAAAACTCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 348} {0: 1, 1: 0, 2: 2, 3: 22, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!