ID: 1165471548_1165471559

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1165471548 1165471559
Species Human (GRCh38) Human (GRCh38)
Location 19:36007327-36007349 19:36007367-36007389
Sequence CCCATCCCCACCCCTCTTCTGTA CTGTGGCACAGTCCATCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 505} {0: 1, 1: 0, 2: 0, 3: 20, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!