ID: 1165511974_1165511985

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1165511974 1165511985
Species Human (GRCh38) Human (GRCh38)
Location 19:36271260-36271282 19:36271302-36271324
Sequence CCATTCCCGATCACCCGCTGGGA AGGAGTCCGCGCAGCCCAGCCGG
Strand - +
Off-target summary No data {0: 33, 1: 0, 2: 4, 3: 14, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!