ID: 1165522837_1165522847

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1165522837 1165522847
Species Human (GRCh38) Human (GRCh38)
Location 19:36328145-36328167 19:36328184-36328206
Sequence CCTACAGGGGACATAGCCGAGGA AAGGGAGTAGGCTGGTTTTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 33, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!