ID: 1165554285_1165554300

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1165554285 1165554300
Species Human (GRCh38) Human (GRCh38)
Location 19:36616852-36616874 19:36616901-36616923
Sequence CCTAAAGTTCAAGTGACTGTAGG CAGGGTGGACAGAGGGATGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 105, 4: 920}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!