ID: 1165567918_1165567924

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1165567918 1165567924
Species Human (GRCh38) Human (GRCh38)
Location 19:36747823-36747845 19:36747859-36747881
Sequence CCTTCCCACATGTCTTACATTCA CAGTGTGAACACTCTGATGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 38, 3: 91, 4: 353} {0: 1, 1: 1, 2: 6, 3: 38, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!