|
Left Crispr |
Right Crispr |
| Crispr ID |
1165567921 |
1165567924 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:36747828-36747850
|
19:36747859-36747881
|
| Sequence |
CCACATGTCTTACATTCATAGGG |
CAGTGTGAACACTCTGATGTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 12, 2: 118, 3: 342, 4: 706} |
{0: 1, 1: 1, 2: 6, 3: 38, 4: 187} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|