ID: 1165618755_1165618756

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1165618755 1165618756
Species Human (GRCh38) Human (GRCh38)
Location 19:37226342-37226364 19:37226355-37226377
Sequence CCACATGGACACTCAGAGTCTAT CAGAGTCTATAGTTTACATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142} {0: 5, 1: 62, 2: 362, 3: 728, 4: 1185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!