ID: 1165717745_1165717748

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1165717745 1165717748
Species Human (GRCh38) Human (GRCh38)
Location 19:38057489-38057511 19:38057517-38057539
Sequence CCTAGGGGTTGATAATTTCTTTA ACTCCTGGTGTTGCTCATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 236} {0: 1, 1: 0, 2: 1, 3: 12, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!