ID: 1165743749_1165743761

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1165743749 1165743761
Species Human (GRCh38) Human (GRCh38)
Location 19:38218433-38218455 19:38218472-38218494
Sequence CCCACCCCTGCAGGCCGCTCTGG GACTGAGGTCAGACTGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 282} {0: 1, 1: 0, 2: 4, 3: 22, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!