ID: 1165751831_1165751840

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1165751831 1165751840
Species Human (GRCh38) Human (GRCh38)
Location 19:38264922-38264944 19:38264952-38264974
Sequence CCGGGCGTTTCTCGCCCTGCTGG GCTCCTCTCTGGGGTCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 140} {0: 1, 1: 0, 2: 6, 3: 51, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!