ID: 1165778960_1165778974

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1165778960 1165778974
Species Human (GRCh38) Human (GRCh38)
Location 19:38421054-38421076 19:38421096-38421118
Sequence CCCTCTGCCCTCCACCCATAGCT AGGTCAGCAGGCGGGCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 416} {0: 1, 1: 0, 2: 2, 3: 34, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!