ID: 1165825752_1165825762

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1165825752 1165825762
Species Human (GRCh38) Human (GRCh38)
Location 19:38704901-38704923 19:38704924-38704946
Sequence CCTTCTGCCCTCTGCCCCCTTCC CTGTGTGCAGAGATTGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 38, 3: 385, 4: 2352} {0: 1, 1: 0, 2: 2, 3: 33, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!