ID: 1165829680_1165829683

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1165829680 1165829683
Species Human (GRCh38) Human (GRCh38)
Location 19:38724234-38724256 19:38724261-38724283
Sequence CCACAAGGAGGCCCAGAGGATCG GAGCAACCACATCAAGCTGTCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 10, 4: 125} {0: 1, 1: 0, 2: 2, 3: 15, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!