ID: 1165829680_1165829684

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1165829680 1165829684
Species Human (GRCh38) Human (GRCh38)
Location 19:38724234-38724256 19:38724262-38724284
Sequence CCACAAGGAGGCCCAGAGGATCG AGCAACCACATCAAGCTGTCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 10, 4: 125} {0: 1, 1: 1, 2: 1, 3: 8, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!