ID: 1165864514_1165864519

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1165864514 1165864519
Species Human (GRCh38) Human (GRCh38)
Location 19:38928260-38928282 19:38928292-38928314
Sequence CCTAGCTACTTGGGAGACTGAGG CACTTGAATCAAGGAGGCGGAGG
Strand - +
Off-target summary {0: 3992, 1: 102915, 2: 212635, 3: 250751, 4: 264126} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!