ID: 1165882692_1165882705

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1165882692 1165882705
Species Human (GRCh38) Human (GRCh38)
Location 19:39054739-39054761 19:39054792-39054814
Sequence CCAGAGTCTAAAATCAGTTTCAC CCTGCCTTCTGGAGGCTCGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 80, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!