ID: 1165901929_1165901941

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1165901929 1165901941
Species Human (GRCh38) Human (GRCh38)
Location 19:39173250-39173272 19:39173280-39173302
Sequence CCTCTCCGGGCCTGATGTCGGCA GCCTGCTGGTCTGGCCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73} {0: 1, 1: 1, 2: 7, 3: 31, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!